| MirGeneDB ID | Sto-Mir-27-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-27 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-27-P3a Sto-Mir-27-P3b Sto-Mir-27-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-27-P2 Ami-Mir-27-P2 Bta-Mir-27-P2 Cfa-Mir-27-P2 Cja-Mir-27-P2 Cli-Mir-27-P2 Cmi-Mir-27-P2 Cpi-Mir-27-P2 Cpo-Mir-27-P2 Dno-Mir-27-P2 Dre-Mir-27-P2a Dre-Mir-27-P2b Eca-Mir-27-P2 Ete-Mir-27-P2 Gga-Mir-27-P2 Gja-Mir-27-P2 Gmo-Mir-27-P2b Hsa-Mir-27-P2 Laf-Mir-27-P2 Lch-Mir-27-P2 Loc-Mir-27-P2 Mal-Mir-27-P2a Mal-Mir-27-P2b Mdo-Mir-27-P2 Mml-Mir-27-P2 Mmr-Mir-27-P2 Mmu-Mir-27-P2 Mun-Mir-27-P2 Neu-Mir-27-P2 Oan-Mir-27-P2 Ocu-Mir-27-P2 Pab-Mir-27-P2 Pbv-Mir-27-P2 Pma-Mir-27-o2 Rno-Mir-27-P2 Sha-Mir-27-P2 Spt-Mir-27-P2 Tgu-Mir-27-P2 Tni-Mir-27-P2b Xla-Mir-27-P2c Xla-Mir-27-P2d Xtr-Mir-27-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01002700.1: 246153-246216 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-27-P2) |
Mir-24-P2
BFAA01002700.1: 238946-239005 [-]
Mir-27-P2 BFAA01002700.1: 246153-246216 [-] Mir-23-P2 BFAA01002700.1: 246394-246453 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCACAGU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCCAUCGAAUAUGACCUUUCUGGUGAGGUACAGAGCUUAGCUGAUUGGUGAACAGUGAUCAUUUUUGCUUUGUUCACAGUGGCUAAGUUCUGCACCAACGAGAGGGAAUGAUGAUCAGGGCUGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UCCAUCGAAUAUGACCU---| G GA A AUUG GUGAUCA UUCU GU GGU CAGAGCUUAGCUG GUGAACA U GAGA CA CCA GUCUUGAAUCGGU CACUUGU U UGUCGGGACUAGUAGUAAGG^ G A- C GA-- UUCGUUU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut +1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-27-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CAGAGCUUAGCUGAUUGGUGAACA -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-27-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- UUCACAGUGGCUAAGUUCUGCA -64
Get sequence
|






