| MirGeneDB ID | Dre-Mir-23-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-23 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Zebrafish (Danio rerio) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dre-mir-23b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dre-Mir-23-P1 Dre-Mir-23-P2b Dre-Mir-23-P3 Dre-Mir-23-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-23-P2 Ami-Mir-23-P2 Bta-Mir-23-P2 Cfa-Mir-23-P2 Cja-Mir-23-P2 Cli-Mir-23-P2 Cmi-Mir-23-P2 Cpi-Mir-23-P2 Cpo-Mir-23-P2 Dno-Mir-23-P2 Eca-Mir-23-P2 Ete-Mir-23-P2 Gga-Mir-23-P2 Gja-Mir-23-P2 Hsa-Mir-23-P2 Laf-Mir-23-P2 Lch-Mir-23-P2 Loc-Mir-23-P2 Mal-Mir-23-P2a Mdo-Mir-23-P2 Mml-Mir-23-P2 Mmr-Mir-23-P2 Mmu-Mir-23-P2 Mun-Mir-23-P2 Neu-Mir-23-P2 Oan-Mir-23-P2 Ocu-Mir-23-P2 Pab-Mir-23-P2 Pbv-Mir-23-P2 Pma-Mir-23-o2 Rno-Mir-23-P2 Sha-Mir-23-P2 Spt-Mir-23-P2 Sto-Mir-23-P2 Tgu-Mir-23-P2 Xtr-Mir-23-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Clupeocephala | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (danRer11) |
chr10: 15954588-15954651 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-23-P2a) |
Mir-23-P2a
chr10: 15954588-15954651 [+]
UCSC
Ensembl
Mir-27-P2a chr10: 15954740-15954804 [+] UCSC Ensembl Mir-24-P2a chr10: 15960847-15960904 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCACAUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACGGGGGUCUCCAGCUUGUUGUGGCUGUGUGGGUUCUUGGCAUGCUGAUUUGUGACUGUAGUAAAAAAAAAUCACAUUGCCAGGGAUUACCACACUACCACGGCAUUACCAGCAGUUCAUGAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GACGGGGGUCUCCAGCU- CU -- -| C GUGACUGU UGUUGUGG GUGUGG GUUCUUGGC AUG UGAUUU \ ACGGCACC CACACC UAGGGACCG UAC ACUAAA A GAGUACUUGACGACCAUU AU AU U^ - AAAAAAUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | For many taxa there is often a higher set of 5p reads shifted -1. However the 5'DcRNA reads support what is annotated here as the actual Drosha cut in relation to the phylogenetically conserved Group 2 3' arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dre-Mir-23-P2a_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGGUUCUUGGCAUGCUGAUUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dre-Mir-23-P2a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0001791 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- AUCACAUUGCCAGGGAUUACCAC -64
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
TargetScanFish: dre-miR-23b |






