| MirGeneDB ID | Pca-Mir-279-o27 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Penis worm (Priapulus caudatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pca-Mir-279-o28 Pca-Mir-279-o29 Pca-Mir-279-o30 Pca-Mir-279-o31 Pca-Mir-279-o32 Pca-Mir-279-o33 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 Tur-Mir-279-P27a Tur-Mir-279-P27b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. caudatus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Priapulus_caudatus_gca000485595v2) |
KQ715408.1: 301499-301556 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-o27) |
Mir-279-o27
KQ715408.1: 301499-301556 [+]
UCSC
Ensembl
Mir-36-P23 KQ715408.1: 303049-303105 [+] UCSC Ensembl Mir-36-P24 KQ715408.1: 303221-303277 [+] UCSC Ensembl Mir-36-P25 KQ715408.1: 303392-303448 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUUGCGGUGCGAAGGAGACCAAUUCCUGUGGAUGACUGUGUUUCUGGUGCAUGUAGUUGAGAACCAUGACUAGAUCCACACUCAUCCACAGUAAGUGGUAAAUGUGACAGCGCGCAGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUUGCGGUGCGAAGGAG--| A C C UU G UAGUU ACCA UU CUGUGGAUGA UGUG UCUGGU CAUG \ UGGU AA GACACCUACU ACAC AGAUCA GUAC G UGACGCGCGACAGUGUAAA^ G U C CU - CAAGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of ecdysozoans and how the priapulid Mir-279s relate to the Mir-279s in nematodes or arthropods and thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pca-Mir-279-o27_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GAUGACUGUGUUUCUGGUGCAUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pca-Mir-279-o27_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UGACUAGAUCCACACUCAUCCA -58
Get sequence
|
