| MirGeneDB ID | Snu-Mir-750 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-750 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-750 Aga-Mir-750 Agr-Mir-750 Asu-Mir-750 Ava-Mir-750-P9 Ava-Mir-750-P10 Bge-Mir-750 Bko-Mir-750 Bpl-Mir-750 Csc-Mir-750-P7 Csc-Mir-750-P8 Cte-Mir-750 Dgr-Mir-750 Dlo-Mir-750 Dma-Mir-750 Dpu-Mir-750 Eba-Mir-750 Efe-Mir-750-P1 Efe-Mir-750-P2 Efe-Mir-750-P3 Esc-Mir-750 Hme-Mir-750 Hru-Mir-750 Isc-Mir-750 Lan-Mir-750 Lgi-Mir-750 Llo-Mir-750 Lpo-Mir-750-P4 Lpo-Mir-750-P5 Lpo-Mir-750-P6 Mgi-Mir-750 Mom-Mir-750 Npo-Mir-750 Obi-Mir-750 Ofu-Mir-750 Ovu-Mir-750 Pau-Mir-750 Pca-Mir-750 Pcr-Mir-750 Pdu-Mir-750 Pve-Mir-750 Rph-Mir-750 Sma-Mir-750 Sme-Mir-750 Tca-Mir-750 Tur-Mir-750 War-Mir-750 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049309.1: 74684902-74684961 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-750) |
Mir-750
CM049309.1: 74684902-74684961 [+]
Mir-1175 CM049309.1: 74691193-74691252 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGAUCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCACGGUGGUUGAUAAUUUGUAUUACCGAGAGCUGAAAGUUUAGAUCUCAGGCAUCCUGUUCUACUGCCAGAUCUAACUCUUCCAGCUCACGUUGAUCCAAAAUUUAUGCAAAAUAGCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCACGGUGGUUGAUAAU-- U C A A U-| CA UCCUG UUG AUUA CG GAGCUG AAG UUAGAUCU GGCA \ AAC UAGU GC CUCGAC UUC AAUCUAGA CCGU U UCCGAUAAAACGUAUUUAA C U A C UC^ -- CAUCU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Snu-Mir-750_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGCUGAAAGUUUAGAUCUCAGGCA -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Snu-Mir-750_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CCAGAUCUAACUCUUCCAGCUCA -60
Get sequence
|






