| MirGeneDB ID | Sto-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-92-P1a Sto-Mir-92-P1b Sto-Mir-92-P1c Sto-Mir-92-P1d Sto-Mir-92-P2b Sto-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2a Ami-Mir-92-P2a Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2a Cel-Mir-92 Cfa-Mir-92-P2a Cja-Mir-92-P2a Cli-Mir-92-P2a Cmi-Mir-92-P2a Cpi-Mir-92-P2a Cpo-Mir-92-P2a Dno-Mir-92-P2a Eca-Mir-92-P2a Esc-Mir-92 Ete-Mir-92-P2a Gga-Mir-92-P2a Gja-Mir-92-P2a Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2a Isc-Mir-92 Laf-Mir-92-P2a Mdo-Mir-92-P2a Mml-Mir-92-P2a Mmr-Mir-92-P2a Mmu-Mir-92-P2a Mun-Mir-92-P2a Neu-Mir-92-P2a Oan-Mir-92-P2a Obi-Mir-92 Ocu-Mir-92-P2a Pab-Mir-92-P2a Rno-Mir-92-P2a Sha-Mir-92-P2a Sme-Mir-92 Spt-Mir-92-P2a Tgu-Mir-92-P2a Xla-Mir-92-P2a Xtr-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01002990.1: 218057-218115 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2a) |
Mir-430-P4
BFAA01002990.1: 216824-216879 [-]
Mir-430-P3 BFAA01002990.1: 217072-217132 [-] Mir-430-P2 BFAA01002990.1: 217783-217842 [-] Mir-92-P2a BFAA01002990.1: 218057-218115 [-] Mir-430-P1 BFAA01002990.1: 218430-218489 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GAAUCCUAAAGAUAGCGGCUACAGUUUACCACCACUGCGAUUGUGCAAUGCUGUUUUCUUGCAUUAGUAUUGCACUUCAGCAAUGGUGAUGUACUGUCCAGUACCAUCAUGGAGGCUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GAAUCCUAAAGAUAGCGGCU--| U C C GAUU GUUUUC ACAGU UA CACCA UGC GUGCAAUGCU \ UGUCA GU GUGGU ACG CACGUUAUGA U CGUCGGAGGUACUACCAUGACC^ U A A ACUU UUACGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-92-P2a_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACCACUGCGAUUGUGCAAUGCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-92-P2a_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUUGCACUUCAGCAAUGGUGA -59
Get sequence
|






