| MirGeneDB ID | Gja-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-92-P1a Gja-Mir-92-P1c Gja-Mir-92-P1d Gja-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2a Ami-Mir-92-P2a Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2a Cel-Mir-92 Cfa-Mir-92-P2a Cja-Mir-92-P2a Cli-Mir-92-P2a Cmi-Mir-92-P2a Cpi-Mir-92-P2a Cpo-Mir-92-P2a Dno-Mir-92-P2a Eca-Mir-92-P2a Esc-Mir-92 Ete-Mir-92-P2a Gga-Mir-92-P2a Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2a Isc-Mir-92 Laf-Mir-92-P2a Mdo-Mir-92-P2a Mml-Mir-92-P2a Mmr-Mir-92-P2a Mmu-Mir-92-P2a Mun-Mir-92-P2a Neu-Mir-92-P2a Oan-Mir-92-P2a Obi-Mir-92 Ocu-Mir-92-P2a Pab-Mir-92-P2a Rno-Mir-92-P2a Sha-Mir-92-P2a Sme-Mir-92 Spt-Mir-92-P2a Sto-Mir-92-P2a Tgu-Mir-92-P2a Xla-Mir-92-P2a Xtr-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015166434.1: 931208-931267 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2a) |
Mir-430-P3
NW_015166434.1: 930789-930847 [+]
Mir-92-P2a NW_015166434.1: 931208-931267 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGCGGAUAUGUACUUUUGCUAUUAUCCUUUACUGUUGCUAAUAUGCAACUCUGUGGCAUAAAAUCUGGAAUUGCACUUUAGCAAUGGUGAUGGAUUAUAAGCUAUGCAAAAAGUUACCAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGCGGAUAUGUACUUUU- -| U U UA C GUGGCA GC UAU AUCC UUACUGUUGCUAA UGCAA UCU U CG AUA UAGG AGUGGUAACGAUU ACGUU AGG A UACCAUUGAAAAACGUAU A^ U U UC A UCUAAA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-92-P2a_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACUGUUGCUAAUAUGCAACUCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-92-P2a_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- AAUUGCACUUUAGCAAUGGUGA -60
Get sequence
|






