| MirGeneDB ID | Gja-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-92-P1a Gja-Mir-92-P1c Gja-Mir-92-P1d Gja-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2c Ami-Mir-92-P2c Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2c Cel-Mir-92 Cfa-Mir-92-P2c Cja-Mir-92-P2c Cli-Mir-92-P2c Cmi-Mir-92-P2c Cpi-Mir-92-P2c Cpo-Mir-92-P2c Dno-Mir-92-P2c Dre-Mir-92-P2c Eca-Mir-92-P2c Esc-Mir-92 Ete-Mir-92-P2c Gga-Mir-92-P2c Gmo-Mir-92-P2c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2c Isc-Mir-92 Laf-Mir-92-P2c Lch-Mir-92-P2c Loc-Mir-92-P2c Mdo-Mir-92-P2c Mml-Mir-92-P2c Mmr-Mir-92-P2c Mmu-Mir-92-P2c Mun-Mir-92-P2c Neu-Mir-92-P2c Oan-Mir-92-P2c Obi-Mir-92 Ocu-Mir-92-P2c Pab-Mir-92-P2c Pbv-Mir-92-P2c Rno-Mir-92-P2c Sha-Mir-92-P2c Sme-Mir-92 Spt-Mir-92-P2c Sto-Mir-92-P2c Tgu-Mir-92-P2c Xla-Mir-92-P2c3 Xla-Mir-92-P2c4 Xtr-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015169856.1: 119070-119134 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2c) |
Mir-92-P2c
NW_015169856.1: 119070-119134 [-]
Mir-92-P1c NW_015169856.1: 119224-119288 [-] Mir-19-P2c NW_015169856.1: 119403-119463 [-] Mir-17-P4c NW_015169856.1: 119534-119595 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGUUGCCCUGAAGCUGUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGAUUAGCAGGACGAAAAUUGCACGGUAUCCAUCUGUAAACCGCAGGACCUUCGUUGCUGACAGGUAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AGUUGCCCUGAAGCUGU--| U GU CA A GAUUAGAU GUUUUGC GUU CGGGUGGAU CG UGCAAUUUU U CAGGACG CAA GUCUACCUA GC ACGUUAAAA A UAUGGACAGUCGUUGCUUC^ C AU UG - GCAGGACG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-92-P2c_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-92-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence
|






