| MirGeneDB ID | Mun-Mir-92-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mun-Mir-92-P1a Mun-Mir-92-P1c Mun-Mir-92-P2a Mun-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-92-P1d Asu-Mir-92 Bfl-Mir-92-o1 Bla-Mir-92-o1 Bta-Mir-92-P1d Cel-Mir-92 Cfa-Mir-92-P1d Cja-Mir-92-P1d Cmi-Mir-92-P1d Cpi-Mir-92-P1d Cpo-Mir-92-P1d Dno-Mir-92-P1d Dre-Mir-92-P1d Eca-Mir-92-P1d Esc-Mir-92 Ete-Mir-92-P1d Gja-Mir-92-P1d Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P1d Isc-Mir-92 Laf-Mir-92-P1d Lch-Mir-92-P1d Loc-Mir-92-P1d Mal-Mir-92-P1d Mdo-Mir-92-P1d Mml-Mir-92-P1d Mmr-Mir-92-P1d Mmu-Mir-92-P1d Oan-Mir-92-P1d Obi-Mir-92 Ocu-Mir-92-P1d Pab-Mir-92-P1d Pbv-Mir-92-P1d Rno-Mir-92-P1d Sha-Mir-92-P1d Sme-Mir-92 Spt-Mir-92-P1d Sto-Mir-92-P1d Tgu-Mir-92-P1d Xla-Mir-92-P1d1 Xla-Mir-92-P1d2 Xtr-Mir-92-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_901765095.2_aMicUni1.2) |
LR594645.1: 38775956-38776018 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUGAUCACUGAUUGGUUCUGAGGGGUCAGGUGGUACGGGGUGCUGUGCAUUGUUGUCCUAUCACCUACCAAUAUUGCACUCGUCCCGGCCUCCUGCCUCCCUGGAUUUCUCUGCAGUAGACUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUGAUCACUGAUUGGUU--| GA U U A GU CU U GUCCUAU CU GGGG CAGG GGU CGGG G GUGCA UGUU \ GG CCUC GUCC CCG GCCC C CACGU AUAA C CUCAGAUGACGUCUCUUUA^ UC C U - UG U- U CCAUCCA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mun-Mir-92-P1d_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGUACGGGGUGCUGUGCAUUGUU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mun-Mir-92-P1d_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- UAUUGCACUCGUCCCGGCCUCC -63
Get sequence
|






