| MirGeneDB ID | Pbv-Mir-92-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-92b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-92-P1a Pbv-Mir-92-P1c Pbv-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-92-P1d Asu-Mir-92 Bfl-Mir-92-o1 Bla-Mir-92-o1 Bta-Mir-92-P1d Cel-Mir-92 Cfa-Mir-92-P1d Cja-Mir-92-P1d Cmi-Mir-92-P1d Cpi-Mir-92-P1d Cpo-Mir-92-P1d Dno-Mir-92-P1d Dre-Mir-92-P1d Eca-Mir-92-P1d Esc-Mir-92 Ete-Mir-92-P1d Gja-Mir-92-P1d Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P1d Isc-Mir-92 Laf-Mir-92-P1d Lch-Mir-92-P1d Loc-Mir-92-P1d Mal-Mir-92-P1d Mdo-Mir-92-P1d Mml-Mir-92-P1d Mmr-Mir-92-P1d Mmu-Mir-92-P1d Mun-Mir-92-P1d Oan-Mir-92-P1d Obi-Mir-92 Ocu-Mir-92-P1d Pab-Mir-92-P1d Rno-Mir-92-P1d Sha-Mir-92-P1d Sme-Mir-92 Spt-Mir-92-P1d Sto-Mir-92-P1d Tgu-Mir-92-P1d Xla-Mir-92-P1d1 Xla-Mir-92-P1d2 Xtr-Mir-92-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE955757.1: 11557-11619 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCCCAGUGUCCCAGAUUCCAGGUUGGGGGCAGGGUUGGGGCUGAGUGCAAUGUUGUGAUUUUUCCCACGAAUAUUGCACUCGUCCUGGCCUCCCGCUGUUCUGGACUCACCUGCGGGGGACACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCCCAGUGUCCCAGAUU-- GU -| CA UG U GUGAUUU CCAG UGG GGG GGGU GGGC GAGUGCAAUGUU \ GGUC GUC CCC UCCG CCUG CUCACGUUAUAA U CACAGGGGGCGUCCACUCA UU G^ -- GU - GCACCCU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-92-P1d_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGGUUGGGGCUGAGUGCAAUGUU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-92-P1d_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038890 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- UAUUGCACUCGUCCUGGCCUCC -63
Get sequence
|






