| MirGeneDB ID | Pbv-Mir-15-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-15 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-16c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-15-P1b Pbv-Mir-15-P1c Pbv-Mir-15-P2a Pbv-Mir-15-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-15-P2c Ami-Mir-15-P2c Bta-Mir-15-P2c Cfa-Mir-15-P2c Cin-Mir-15-P2 Cja-Mir-15-P2c Cli-Mir-15-P2c Cmi-Mir-15-P2c Cpi-Mir-15-P2c Cpo-Mir-15-P2c Dno-Mir-15-P2c Dre-Mir-15-P2c-v1 Eca-Mir-15-P2c Ete-Mir-15-P2c Gga-Mir-15-P2c Gja-Mir-15-P2c Hsa-Mir-15-P2c Laf-Mir-15-P2c Lch-Mir-15-P2c Loc-Mir-15-P2c Mdo-Mir-15-P2c-v1 Mml-Mir-15-P2c Mmr-Mir-15-P2c Mmu-Mir-15-P2c Mun-Mir-15-P2c Neu-Mir-15-P2c-v1 Oan-Mir-15-P2c Ocu-Mir-15-P2c Pab-Mir-15-P2c Rno-Mir-15-P2c3 Rno-Mir-15-P2c4 Sha-Mir-15-P2c-v1 Spt-Mir-15-P2c Tgu-Mir-15-P2c Xla-Mir-15-P2c1 Xla-Mir-15-P2c2 Xtr-Mir-15-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Olfactores | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE958055.1: 56683-56743 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-15-P2c) |
Mir-15-P2c
KE958055.1: 56683-56743 [-]
Mir-15-P1c KE958055.1: 57374-57431 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCAGCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAGAAACGGAAAAGUCUGUCUGCUCUGCUUUAGCAGCACGUAAAUACUGGAGUUUAGAUGCUCUGCCCUCCAGUAUUGCUUUGCUGCUUUAGUCAAGCUGGCACAUGCUCCAGGGAAUUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAGAAACGGAAAAGUCU--| U CU UU CGUA UUUAGAU GUC GCU GCU AGCAGCA AAUACUGGAG \ CGG CGA UGA UCGUCGU UUAUGACCUC G CGUUAAGGGACCUCGUACA^ U AC UU UUCG CCGUCUC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-15-P2c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038836 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAGCAGCACGUAAAUACUGGAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-15-P2c_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038837 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UCCAGUAUUGCUUUGCUGCUUUA -61
Get sequence
|






