| MirGeneDB ID | Pbv-Mir-17-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-106 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-17-P1a Pbv-Mir-17-P2a Pbv-Mir-17-P2c Pbv-Mir-17-P4a Pbv-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P1c Ami-Mir-17-P1c Bta-Mir-17-P1c Cfa-Mir-17-P1c Cja-Mir-17-P1c Cli-Mir-17-P1c Cmi-Mir-17-P1c Cpi-Mir-17-P1c Cpo-Mir-17-P1c Dno-Mir-17-P1c Eca-Mir-17-P1c Ete-Mir-17-P1c Gga-Mir-17-P1c Gja-Mir-17-P1c Hsa-Mir-17-P1c Laf-Mir-17-P1c Lch-Mir-17-P1c Loc-Mir-17-P1c Mdo-Mir-17-P1c Mml-Mir-17-P1c Mmr-Mir-17-P1c Mmu-Mir-17-P1c Mun-Mir-17-P1c Neu-Mir-17-P1c Oan-Mir-17-P1c Ocu-Mir-17-P1c Pab-Mir-17-P1c Rno-Mir-17-P1c Sha-Mir-17-P1c Spt-Mir-17-P1c Sto-Mir-17-P1c Tgu-Mir-17-P1c Xla-Mir-17-P1c3 Xla-Mir-17-P1c4 Xtr-Mir-17-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE958055.1: 3752-3809 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P1c) |
Mir-92-P2c
KE958055.1: 115-179 [-]
Mir-92-P1c KE958055.1: 286-347 [-] Mir-19-P2c KE958055.1: 454-514 [-] Mir-17-P4c KE958055.1: 600-662 [-] Mir-17-P2c KE958055.1: 3575-3639 [-] Mir-17-P1c KE958055.1: 3752-3809 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAAGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCCGGAGUUUGGGGAAGCCAUCGGUGGUGCAAAAGUGCUUAUAGUGCAGGUAGUCCAGUGAUCUCUACUGCAGUGUUAGCACUUCAGUGGCACAAUGGCACGGUGGCGCAGGAUGGGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCCGGAGUUUGGGGAAG---| CG G AA U G G UCCAG CCAU GUG UGC AAGUGCU AUA UGCAG UAG \ GGUA CAC GUG UUCACGA UGU ACGUC AUC U CGGGUAGGACGCGGUGGCAC^ A- G AC U G - UCUAG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-17-P1c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038905 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAAAGUGCUUAUAGUGCAGGUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-17-P1c_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038906 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- ACUGCAGUGUUAGCACUUCAGU -58
Get sequence
|






