| MirGeneDB ID | Mun-Mir-17-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mun-Mir-17-P1a Mun-Mir-17-P2a Mun-Mir-17-P2c Mun-Mir-17-P4a Mun-Mir-17-P4d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P1c Ami-Mir-17-P1c Bta-Mir-17-P1c Cfa-Mir-17-P1c Cja-Mir-17-P1c Cli-Mir-17-P1c Cmi-Mir-17-P1c Cpi-Mir-17-P1c Cpo-Mir-17-P1c Dno-Mir-17-P1c Eca-Mir-17-P1c Ete-Mir-17-P1c Gga-Mir-17-P1c Gja-Mir-17-P1c Hsa-Mir-17-P1c Laf-Mir-17-P1c Lch-Mir-17-P1c Loc-Mir-17-P1c Mdo-Mir-17-P1c Mml-Mir-17-P1c Mmr-Mir-17-P1c Mmu-Mir-17-P1c Neu-Mir-17-P1c Oan-Mir-17-P1c Ocu-Mir-17-P1c Pab-Mir-17-P1c Pbv-Mir-17-P1c Rno-Mir-17-P1c Sha-Mir-17-P1c Spt-Mir-17-P1c Sto-Mir-17-P1c Tgu-Mir-17-P1c Xla-Mir-17-P1c3 Xla-Mir-17-P1c4 Xtr-Mir-17-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_901765095.2_aMicUni1.2) |
LR594638.1: 44966335-44966391 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P1c) |
Mir-17-P1c
LR594638.1: 44966335-44966391 [+]
Mir-17-P2c LR594638.1: 44966461-44966525 [+] Mir-19-P2c LR594638.1: 44966841-44966899 [+] Mir-92-P1c LR594638.1: 44966992-44967054 [+] Mir-92-P2c LR594638.1: 44967139-44967203 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAAGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GAUAAUUGGUAGUGGAUGCCUUAGUUAUGCAAAAGUGCUUACAGUGCAGGUAGUAUUCUGUACCUACUGCAAUGGAAGCACUUGCAGCCUUACUAUGGUGAUAAUGUUGGGCACCUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GAUAAUUGGUAGUGGAU- U UA---| AA A G G UAUU GCC UAGU UGCA AGUGCUU CA UGCAG UAG C UGG AUCA ACGU UCACGAA GU ACGUC AUC U AUCCACGGGUUGUAAUAG U UUCCG^ -- G A - CAUG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mun-Mir-17-P1c_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAAAGUGCUUACAGUGCAGGUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mun-Mir-17-P1c_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- ACUGCAAUGGAAGCACUUGCAG -57
Get sequence
|






