| MirGeneDB ID | Sko-Mir-71 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-71 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Saccoglossus (Saccoglossus kowalevskii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | sko-mir-71 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-71 Aga-Mir-71 Agr-Mir-71 Asu-Mir-71 Ava-Mir-71-P20 Ava-Mir-71-P21 Bfl-Mir-71 Bge-Mir-71 Bla-Mir-71 Cbr-Mir-71 Cel-Mir-71 Csc-Mir-71-P14 Csc-Mir-71-P15 Cte-Mir-71 Dgr-Mir-71 Dlo-Mir-71 Dma-Mir-71 Dpu-Mir-71 Efe-Mir-71-P1 Efe-Mir-71-P2 Efe-Mir-71-P3 Egr-Mir-71 Esc-Mir-71 Gsa-Mir-71-o7 Gsa-Mir-71-o8 Hme-Mir-71 Hru-Mir-71 Isc-Mir-71 Lan-Mir-71-P4 Lan-Mir-71-P5 Lgi-Mir-71 Lhy-Mir-71 Llo-Mir-71 Lpo-Mir-71-P7 Lpo-Mir-71-P8 Lpo-Mir-71-P9 Lpo-Mir-71-P10 Lpo-Mir-71-P11 Lpo-Mir-71-P12 Lpo-Mir-71-P13 Mgi-Mir-71 Mom-Mir-71 Npo-Mir-71 Obi-Mir-71 Ofu-Mir-71 Ovu-Mir-71 Pau-Mir-71 Pca-Mir-71 Pcr-Mir-71-v1 Pdu-Mir-71 Pfl-Mir-71 Ple-Mir-71 Pmi-Mir-71 Pve-Mir-71 Rph-Mir-71 Sma-Mir-71-o5 Sma-Mir-71-o6 Sme-Mir-71-o1a Sme-Mir-71-o1b Sme-Mir-71-o2 Sme-Mir-71-o3 Sme-Mir-71-o4 Snu-Mir-71 Spu-Mir-71 Tca-Mir-71 Tur-Mir-71-P6a Tur-Mir-71-P6b War-Mir-71 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Skow_1.1) |
NW_003142845.1: 55183-55242 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-71) |
Mir-4830-P4
NW_003142845.1: 32678-32738 [-]
Mir-71 NW_003142845.1: 55183-55242 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAAAGAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGAAGGAUUGCAUUACUGGUGGGUGUUUUGUGAAAGACACAGGUAGUGAGAUAGUGUAUGGUAAACAUCUCGCUACUUUGGUCUCUCUCCAUAGCACCUUGCCAAAAUCUUCACAGCGGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGAAGGAUUGCAUUACUGGU- U U-| A AC AGUGUA GGGUGUU UG GA AGAC AGGUAGUGAGAU U UCCACGA AC CU UCUG UUCAUCGCUCUA G UGGCGACACUUCUAAAACCGU U CU^ C GU CAAAUG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sko-Mir-71_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009617 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAAAGACACAGGUAGUGAGAU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sko-Mir-71_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CUCGCUACUUUGGUCUCUCUCC -60
Get sequence
|






