| MirGeneDB ID | Sto-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-17 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-17-P1a Sto-Mir-17-P1b Sto-Mir-17-P1c Sto-Mir-17-P1d Sto-Mir-17-P2a Sto-Mir-17-P2c Sto-Mir-17-P3b Sto-Mir-17-P4a Sto-Mir-17-P4b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-17-P4c Ami-Mir-17-P4c Bta-Mir-17-P4c Cfa-Mir-17-P4c Cja-Mir-17-P4c Cli-Mir-17-P4c Cmi-Mir-17-P4c Cpi-Mir-17-P4c Cpo-Mir-17-P4c Dno-Mir-17-P4c Dre-Mir-17-P4c Eca-Mir-17-P4c Ete-Mir-17-P4c Gga-Mir-17-P4c Gja-Mir-17-P4c Gmo-Mir-17-P4c Hsa-Mir-17-P4c Laf-Mir-17-P4c Lch-Mir-17-P4c Loc-Mir-17-P4c Mal-Mir-17-P4c Mdo-Mir-17-P4c Mml-Mir-17-P4c Mmr-Mir-17-P4c Mmu-Mir-17-P4c Neu-Mir-17-P4c Oan-Mir-17-P4c Ocu-Mir-17-P4c Pab-Mir-17-P4c Pbv-Mir-17-P4c Rno-Mir-17-P4c Sha-Mir-17-P4c Spt-Mir-17-P4c Tgu-Mir-17-P4c Xla-Mir-17-P4c3 Xla-Mir-17-P4c4 Xtr-Mir-17-P4c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01013767.1: 4955-5015 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-17-P4c) |
Mir-17-P1c
BFAA01013767.1: 3033-3091 [+]
Mir-17-P2c BFAA01013767.1: 3215-3279 [+] Mir-19-P1c BFAA01013767.1: 4765-4822 [+] Mir-17-P4c BFAA01013767.1: 4955-5015 [+] Mir-19-P2c BFAA01013767.1: 5089-5150 [+] Mir-92-P1c BFAA01013767.1: 5248-5309 [+] Mir-92-P2c BFAA01013767.1: 5411-5474 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAAGUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAUGUAUCUAUCUAGAUGUCCAGGCAGCACCAAAGUGCUCAUAGUGCAGGUAGUAGUGAACAAAAUCUACUGUAAUAUGAGCACUUAUAGUCAUGCUCGACAAAUCACAAUAAAAAGCCAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UAUGUAUCUAUCUAGAU---| CA GC CA- G G UAGUGA GUC GGCA AC AAGUGCUCAUA UGCAG UAG \ CAG UCGU UG UUCACGAGUAU AUGUC AUC A AACCGAAAAAUAACACUAAA^ C- AC AUA A - UAAAAC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut -1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-17-P4c_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CAAAGUGCUCAUAGUGCAGGUAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-17-P4c_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- ACUGUAAUAUGAGCACUUAUAGU -61
Get sequence
|






