| MirGeneDB ID | Pbv-Mir-130-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-130c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-130-P1b Pbv-Mir-130-P1c Pbv-Mir-130-P2a Pbv-Mir-130-P2b Pbv-Mir-130-P3a Pbv-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P1a Ami-Mir-130-P1a Cli-Mir-130-P1a Cmi-Mir-130-P1a Cpi-Mir-130-P1a Dre-Mir-130-P1a1 Dre-Mir-130-P1a2 Gga-Mir-130-P1a Gja-Mir-130-P1a Gmo-Mir-130-P1a1 Gmo-Mir-130-P1a2 Lch-Mir-130-P1a Loc-Mir-130-P1a Mal-Mir-130-P1a1 Mal-Mir-130-P1a2 Mdo-Mir-130-P1a Mun-Mir-130-P1a Oan-Mir-130-P1a Sha-Mir-130-P1a Spt-Mir-130-P1a Sto-Mir-130-P1a Tgu-Mir-130-P1a Tni-Mir-130-P1a2 Xla-Mir-130-P1a3 Xla-Mir-130-P1a4 Xtr-Mir-130-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE953167.1: 486603-486663 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-130-P1a) |
Mir-130-P1a
KE953167.1: 486603-486663 [+]
Mir-130-P2a KE953167.1: 488663-488725 [+] Mir-130-P3a KE953167.1: 505152-505216 [+] Mir-130-P4a KE953167.1: 507030-507091 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCCUUGGCGCUCGCUCUCCUUGUCGUCCUGUGCCCUUUUUCUGUUGUACUACUGGGAGCUCUCAUUAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCAGAGGUUGUUCCUCCCUUUCUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCCUUGGCGCUCGCUCU- -| U U UC A GGGAGC CCU UGUCG CC GUGCCCUUUU UGUUGUACU CU \ GGA ACGGU GG UACGGGAAAA AUAACGUGA GA U CUUCUUUCCCUCCUUGUU G^ C U UU C UUACUC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There are Drosha cuts -1 and +1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-130-P1a_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038929 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGCCCUUUUUCUGUUGUACUACU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-130-P1a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038930 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CAGUGCAAUAUUAAAAGGGCAUU -61
Get sequence
|
