| MirGeneDB ID | Sto-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-130-P1a Sto-Mir-130-P1b Sto-Mir-130-P1c Sto-Mir-130-P2a Sto-Mir-130-P2b Sto-Mir-130-P3a Sto-Mir-130-P3b Sto-Mir-130-P3c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P4a Bta-Mir-130-P4a Cfa-Mir-130-P4a Cja-Mir-130-P4a Cmi-Mir-130-P4a Cpi-Mir-130-P4a Cpo-Mir-130-P4a Dno-Mir-130-P4a Dre-Mir-130-P4a1 Eca-Mir-130-P4a Ete-Mir-130-P4a Gga-Mir-130-P4a Gja-Mir-130-P4a Hsa-Mir-130-P4a Laf-Mir-130-P4a Lch-Mir-130-P4a Loc-Mir-130-P4a Mal-Mir-130-P4a1 Mdo-Mir-130-P4a Mml-Mir-130-P4a Mmr-Mir-130-P4a Mmu-Mir-130-P4a Mun-Mir-130-P4a Ocu-Mir-130-P4a Pab-Mir-130-P4a Pbv-Mir-130-P4a Rno-Mir-130-P4a Sha-Mir-130-P4a Spt-Mir-130-P4a Tgu-Mir-130-P4a Xla-Mir-130-P4a3 Xla-Mir-130-P4a4 Xtr-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01012481.1: 69134-69193 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-130-P4a) |
Mir-130-P1a
BFAA01012481.1: 61197-61254 [+]
Mir-130-P2a BFAA01012481.1: 61702-61763 [+] Mir-130-P3a BFAA01012481.1: 68285-68351 [+] Mir-130-P4a BFAA01012481.1: 69134-69193 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUUGCUGAUGCACAUCCUCAGGCUCCUGCCGCUCUGUCAGUGUUGCGCUACUGUGGACCUGGCGCGAGCAGUGCAAUAUUGAAAGAGCAGCAGUGGCCCGAGCACAGUCGACUAGUACGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUUGCUGAUGCACAUCC--| A UC C G A GUGGAC UC GGC CUGC GCUCU UCAGUGUUGCGCU CU C AG CCG GACG CGAGA AGUUAUAACGUGA GA U UGCAUGAUCAGCUGACACG^ C GU A A C GCGCGG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-130-P4a_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUCUGUCAGUGUUGCGCUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-130-P4a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CAGUGCAAUAUUGAAAGAGCAG -60
Get sequence
|






